View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_low_34 (Length: 260)
Name: NF13237_low_34
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 8946141 - 8946376
Alignment:
| Q |
11 |
ttattcttgatgtacgatttggtgatttctccatctattggactgataaagatgtttgcataacttaagtcttgaaaactatactcttcttttctaaaga |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8946141 |
ttattcttgatgtatgatttggtgatttctccatctattggactaataaagatgtttgcataacttaagtcttgaaaactatactcttcttttctaaaga |
8946240 |
T |
 |
| Q |
111 |
agtcgaaatttgatatatttgatatgaaaacagctccaacaacgtttgctcgatacacattagtatattgttcaataatatctccatcgtcacaaaccac |
210 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8946241 |
aatcaaaatttgatatatttgatatgaaaacagctccaacaacgtttgcttgatacacataagaatattgttcaataatatctccatcgtcacaaaccac |
8946340 |
T |
 |
| Q |
211 |
aatattgttcttcactttgattaattctgtaacatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8946341 |
aatattgttcttcactttgattaattctgtaacatt |
8946376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University