View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_low_35 (Length: 252)
Name: NF13237_low_35
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_low_35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 11974425 - 11974659
Alignment:
| Q |
18 |
acaatttcaacgtttgcaaattgctaagcttggtaatggaattgggtaacttttctatagaattaagggacaggtcgagatacctcaaattattcatatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11974425 |
acaatttcaacgtttgcaaattgctaagcttggtaatggaattgggtaacttttctatagaattaagggacaggtcgagatacctcaaattattcatatc |
11974524 |
T |
 |
| Q |
118 |
cccaattgagttgggcaatgtcttgattcccatgtcgtggagatccaacattcggagagtggccttgaaggatttgaatatttgaccacaagtggaatag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11974525 |
cccaattgagttgggcaatgtcttgattcccatgtcgtggagatccaacattcggagagtggccttgaaggatttgaatatttgaccacaagtggaatag |
11974624 |
T |
 |
| Q |
218 |
cctgtcttcatgtccttcggaagcaacgattgtgt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11974625 |
cctgtcttcatgtccttcggaagcaacgattgtgt |
11974659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University