View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_low_7 (Length: 523)
Name: NF13237_low_7
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 5e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 23622068 - 23621892
Alignment:
| Q |
1 |
aaaaagctaaaaggaccaaatataagggacggatgtagtaatattgtaacatctcaattttcagaccggtagtggtgaaatttcaaactctaaatgcgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23622068 |
aaaaagctaaaaggaccaaatataagggacggatgtagcaatattgtaacatctcaattttcagagcggtagtggtgaaatttcaaactctaaatgcgga |
23621969 |
T |
 |
| Q |
101 |
ataatttgaaaacagttacttttaatcacctttacaaaaatctgtataatgcaagtaagtcatacactaaaatacct |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23621968 |
ataatttgaaaacagttacttttaatcacctttacaaaaatctgtataatgcaagtaagtcagacactaaaatacct |
23621892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 26 - 154
Target Start/End: Complemental strand, 23618041 - 23617913
Alignment:
| Q |
26 |
gggacggatgtagtaatattgtaacatctcaattttcagaccggtagtggtgaaatttcaaactctaaatgcggaataatttgaaaacagttacttttaa |
125 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| || |||| |||||||||||| ||||||||||| | |||||||||||||| ||||| |||| |
|
|
| T |
23618041 |
gggacggatgtagaaatattgtaacatctcaactttcggagcggtggtggtgaaattttaaactctaaatttgaaataatttgaaaaccattactcttaa |
23617942 |
T |
 |
| Q |
126 |
tcacctttacaaaaatctgtataatgcaa |
154 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
23617941 |
tcgcctttacaaaaatctgtataatgcaa |
23617913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 23618097 - 23618043
Alignment:
| Q |
1 |
aaaaagctaaaaggaccaaatataagggacggatgtagtaatattgtaacatctc |
55 |
Q |
| |
|
|||| ||||||||||||||| || ||||| |||||||| |||||||||||||||| |
|
|
| T |
23618097 |
aaaaggctaaaaggaccaaaaattagggatggatgtagaaatattgtaacatctc |
23618043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University