View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13238_high_15 (Length: 297)
Name: NF13238_high_15
Description: NF13238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13238_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 24 - 135
Target Start/End: Original strand, 41348517 - 41348628
Alignment:
| Q |
24 |
agaataagtatacaggtaaaatcagctctaatgaaagaaattagaagccaataaaattctgttttattgcacttattttttatactatcggttagcttat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41348517 |
agaataagtatacaggtaaaatcagctctaatgaaagaaattagaagccaataaaattctgttttattgcacttattttttatactatcggttagcatat |
41348616 |
T |
|
| Q |
124 |
ctgtgttgtact |
135 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41348617 |
ctgtgttgtact |
41348628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 192 - 291
Target Start/End: Original strand, 41348686 - 41348785
Alignment:
| Q |
192 |
ttgagaggagatgaaaagtgcagtagataagagtgtgtcagcaaagagtggcaaacatgacagaaatggaacatgctccgatgccaagtattcatatcac |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41348686 |
ttgagaggagatgaaaagtgcagtagataagagtgtgtcagcaaagagtggcaaacatgacagaaatggaacatgctccgatgccaagtattcatatcac |
41348785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University