View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13238_low_18 (Length: 264)
Name: NF13238_low_18
Description: NF13238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13238_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 97 - 234
Target Start/End: Complemental strand, 25670871 - 25670733
Alignment:
| Q |
97 |
acccttcatctaattttgcctagaaacttaaagggtaccctccctttcatcatacattcatatgggg-gcataaagtttgtattttcttcacaacccttc |
195 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | ||||| |
|
|
| T |
25670871 |
acccttcatttaattttgcttaaaaacttaaagggtaccctccctttcatcatacattcatatggggtgcataaagtttgtattttaatcatagtccttc |
25670772 |
T |
|
| Q |
196 |
atctaattttgcttaaaagggttattttgcatcttataa |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
25670771 |
atctaattttgcttaaaagactttttttgcagcttataa |
25670733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 25670991 - 25670922
Alignment:
| Q |
9 |
gattattctggtggctatgttattcatctttcttctggaattgctggtttcactgctgcttattgggtaa |
78 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25670991 |
gattattctggtggttatgttattcatctttcttctggaattgctggtttcactgctgcttattgggtaa |
25670922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 25670893 - 25670847
Alignment:
| Q |
167 |
taaagtttgtattttcttcacaacccttcatctaattttgcttaaaa |
213 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25670893 |
taaattttgtatttttttcacaacccttcatttaattttgcttaaaa |
25670847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 47501682 - 47501734
Alignment:
| Q |
24 |
tatgttattcatctttcttctggaattgctggtttcactgctgcttattgggt |
76 |
Q |
| |
|
||||||||||| || ||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
47501682 |
tatgttattcacctctctgctggtgttgctggttttactgctgcttattgggt |
47501734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 9 - 76
Target Start/End: Complemental strand, 39726455 - 39726388
Alignment:
| Q |
9 |
gattattctggtggctatgttattcatctttcttctggaattgctggtttcactgctgcttattgggt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
39726455 |
gattattctggtggttatgttattcatctttcttctgggattgctggtttcaccgctgcttattgggt |
39726388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 31606189 - 31606237
Alignment:
| Q |
30 |
attcatctttcttctggaattgctggtttcactgctgcttattgggtaa |
78 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
31606189 |
attcatctatcttctggtgttgcaggtttcactgctgcttattgggtaa |
31606237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 79
Target Start/End: Complemental strand, 5625196 - 5625132
Alignment:
| Q |
15 |
tctggtggctatgttattcatctttcttctggaattgctggtttcactgctgcttattgggtaaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
5625196 |
tctggtggctatgttattcatctttcttctggaattggtggattcactgcagcttattgggtaaa |
5625132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 13349913 - 13349844
Alignment:
| Q |
9 |
gattattctggtggctatgttattcatctttcttctggaattgctggtttcactgctgcttattgggtaa |
78 |
Q |
| |
|
||||| |||||||| ||||| |||||| | |||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
13349913 |
gattactctggtggttatgtcattcatttgtcttctggggttgctgggtttactgctgcttattgggtaa |
13349844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University