View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13238_low_24 (Length: 237)
Name: NF13238_low_24
Description: NF13238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13238_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 43665878 - 43665673
Alignment:
| Q |
18 |
aatttaatcagcactgctttcttctttgaagctgaaattagcactttcctttagagtttgtagaatgtcttttaagtagttctagtttagactgagtcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665878 |
aatttaatcagcactgctttcttctttgaagctgaaattagcactttactttagagtttgtagaatgtcttttaagtagttctagtttagactgagtcat |
43665779 |
T |
|
| Q |
118 |
cttccagatcaaccataatcaatgtagtggttactggtcatgaatgattggatgtgtatagtgttcaaacttttcagaatttgttttagttttacctttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665778 |
cttccagatcaaccataatcaatgtagtggttactggtcatgaatgattggatgtgtatagtgttcaaacttttcagaatttgttttagttttacctttt |
43665679 |
T |
|
| Q |
218 |
ctctgc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
43665678 |
ctctgc |
43665673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University