View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13238_low_26 (Length: 236)
Name: NF13238_low_26
Description: NF13238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13238_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10331182 - 10330958
Alignment:
| Q |
1 |
ataattccataccttcgattgagactactgctgtgaagtgatatcgatggaagagtactcttgatatatat--ttccccacatattttttatggggaaca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10331182 |
ataattccataccttcgattgagactactgctgtggagtgatatcgatggaagagtactcttgatatatatatttccccacatattttttatggggaaca |
10331083 |
T |
 |
| Q |
99 |
agatcaaattttagataactatcgtaatctatttggctatagatatcttttttgtttcctcgcgtgaaaaactcacaatatacagtacattaactatata |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
10331082 |
agatcaaattttagataactatcataatctatttggctatagatatcttttttgtttcctcgcgtgaaaaattcacaatatatagtacattaactatata |
10330983 |
T |
 |
| Q |
199 |
gcaatctcatactcaaagaagaatc |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10330982 |
gcaatctcatactcaaagaagaatc |
10330958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University