View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13238_low_27 (Length: 232)
Name: NF13238_low_27
Description: NF13238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13238_low_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 30850940 - 30851166
Alignment:
| Q |
1 |
agatggaaagttttgttttctttcnnnnnnnngatggagagttttgtctaaagtgaaagacgccaccgccatcctaaactaccacaaagcctcattacac |
100 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30850940 |
agatagaaagttttgttttctttcaaaaaaaagatggagagttttgtctaaagtgaaagacgccaccgccatcctaaactaccacaaagcctcat-acac |
30851038 |
T |
 |
| Q |
101 |
gtttttagtccattttctgctttgcaacacatgcatctttctatgacatttcataacaatgtctattagaggatcacactttcttatacctatttattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30851039 |
gtttttagtccattttctgctttgcaacacatgcatctttctatgacatttcataacaatgtctattagaggatcacactttcttatacctatttattag |
30851138 |
T |
 |
| Q |
201 |
aggatccacattgataatacatcaccaccaat |
232 |
Q |
| |
|
| ||||||||||| |||||||||||||||| |
|
|
| T |
30851139 |
a-gatccacattg---atacatcaccaccaat |
30851166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University