View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13239_high_10 (Length: 247)
Name: NF13239_high_10
Description: NF13239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13239_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 10621760 - 10621536
Alignment:
| Q |
13 |
aaaatagatagccttaagatccaacttgcaacatgaactacgactttcctttttaacttgacttaggaaaatacattgatttagggcctaaacccttgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10621760 |
aaaatagatagccttaagatccaacttgcaacatgaactacgactttcctttttaacttgacttacgaaaatacattgatttagggcctaaacccttgtt |
10621661 |
T |
|
| Q |
113 |
taattagtggcgacccccttgaactggccatattgataaccatttttgtgaaacaaaaatatgaaatctctcttatcctattactaaatttagctacaag |
212 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
10621660 |
t---tagtggcgacccccttgaactggccatgctgataaccatttttgagaaactaaaatatgaaatctctcttatcttattactaaatttagctacgag |
10621564 |
T |
|
| Q |
213 |
agtgataaatataaattatcctctctaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
10621563 |
agtgataaatataaactatcctctctaa |
10621536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 17278963 - 17278893
Alignment:
| Q |
169 |
aaatatgaaatctctcttatcctattactaaatttagctacaagagtgataaatataaattatcctctcta |
239 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| || |||||||||||||| ||||||| |||||| |
|
|
| T |
17278963 |
aaatatgaaatctctctaatccaattactaaatttagtaacgagagtgataaatatcaattatcttctcta |
17278893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University