View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13239_low_12 (Length: 247)
Name: NF13239_low_12
Description: NF13239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13239_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 49986296 - 49986145
Alignment:
| Q |
18 |
gatgattggatcgagattggatggtggcatggtgcagatctcaagcttggcatttaagagtaataaaatcaaaatatgatttctttttgcaccgtccaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986296 |
gatgattggatcgagattggatggtggcatggtgcagatctcaagcttggcatttaagagtaataaaatcaaaatatgatttctttttgcaccgtccaat |
49986197 |
T |
|
| Q |
118 |
ccctatccaaatgccactaatgtgtttattgcatgaatgcgtggactggaga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49986196 |
ccctatccaaatgccactaatgtgtttattgcatgaatgcgtggactggaga |
49986145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 167 - 247
Target Start/End: Complemental strand, 49986096 - 49986016
Alignment:
| Q |
167 |
agaaagtgagggccaaggaaagtgaagatgtaacactagcatttgacaggagacaaaataatacaaggcagcatgttttat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
49986096 |
agaaagtgagggccaaggaaagtgaagatgtaacactagcatttgacagcagacaaaatgctacaaggcagcatgttttat |
49986016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University