View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13239_low_12 (Length: 247)

Name: NF13239_low_12
Description: NF13239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13239_low_12
NF13239_low_12
[»] chr3 (2 HSPs)
chr3 (18-169)||(49986145-49986296)
chr3 (167-247)||(49986016-49986096)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 49986296 - 49986145
Alignment:
18 gatgattggatcgagattggatggtggcatggtgcagatctcaagcttggcatttaagagtaataaaatcaaaatatgatttctttttgcaccgtccaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49986296 gatgattggatcgagattggatggtggcatggtgcagatctcaagcttggcatttaagagtaataaaatcaaaatatgatttctttttgcaccgtccaat 49986197  T
118 ccctatccaaatgccactaatgtgtttattgcatgaatgcgtggactggaga 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
49986196 ccctatccaaatgccactaatgtgtttattgcatgaatgcgtggactggaga 49986145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 167 - 247
Target Start/End: Complemental strand, 49986096 - 49986016
Alignment:
167 agaaagtgagggccaaggaaagtgaagatgtaacactagcatttgacaggagacaaaataatacaaggcagcatgttttat 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||  ||||||||||||||||||||    
49986096 agaaagtgagggccaaggaaagtgaagatgtaacactagcatttgacagcagacaaaatgctacaaggcagcatgttttat 49986016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University