View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_high_19 (Length: 312)
Name: NF1323_high_19
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 54910118 - 54910401
Alignment:
| Q |
1 |
tgagttgtttgtttgtttgggaagtgatagaaagtttctccattgcgttgataaacttgcgcaaatacttgatgtactcggggaaagtttcaaggttgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910118 |
tgagttgtttgtttgtttgggaagtgatagaaagtttatccattgcgttgataaacttgcgcaaatacttgatgtactcggggaaagtttcaaggttgca |
54910217 |
T |
 |
| Q |
101 |
atggcctccacctttaacccacaaggggtcatatttttcctttgagagctcccacaaccgctttccatgagaacaatccacaatttcatcttctgttccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910218 |
atggcctccacctttaacccacaaggggtcatatttttcctttgagagctcccacaaccgctttccatgagaacaatccacaatttcatcttctgttccc |
54910317 |
T |
 |
| Q |
201 |
tgtaaacaatccataagcagaaacaaaactattattagtgtc-aaaaatatccatgtcagttgtgatgctttctgtagactata |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54910318 |
tgtaaacaatccataagcagaaacaaaactattattagtgtcaaaaaatatccatgtcagttgtgatgctttctgcagactata |
54910401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University