View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_high_20 (Length: 307)
Name: NF1323_high_20
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 31 - 278
Target Start/End: Original strand, 40369526 - 40369773
Alignment:
| Q |
31 |
ccatttcaatacttcaattgtccaaatagttttgccttgaaaatcactcatactaaactaagcaaggcttatatacgacatctaatggttaaacttgatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||| ||| |
|
|
| T |
40369526 |
ccatttcaatacttcaattgtccaaatagttttgccgtgaaaatcactcacactaaactaagcaaggcttatatacaagatctaatggttaaactttatt |
40369625 |
T |
|
| Q |
131 |
agagattgtacttctcaccaatggatttttaggtggagggagcatttggttttatgacttttattctattgcttggattccggactcgtttggaaactaa |
230 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
40369626 |
agagattgtacttctcactaatggacttttaggtggagggagcatttggttttatgacttttattctattgcttggattccggactcgtctggaagctaa |
40369725 |
T |
|
| Q |
231 |
cgtctaattatattagatggcgatgatttgatcatagagatttatctg |
278 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
40369726 |
cgtgtaattatattagatggcgatgatttgatcatggggatttatctg |
40369773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 56 - 155
Target Start/End: Complemental strand, 40066338 - 40066241
Alignment:
| Q |
56 |
atagttttgccttgaaaatcactcatactaaactaagcaaggcttatatacgacatctaatggttaaacttgattagagattgtacttctcaccaatgga |
155 |
Q |
| |
|
|||||||||| ||||||||||||| | || ||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40066338 |
atagttttgcagtgaaaatcactcacattatactaagcaaggcttata--cgagatctaatggttaaccttgattagagattgtacttctcaccaatgga |
40066241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University