View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_high_35 (Length: 208)
Name: NF1323_high_35
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 7 - 107
Target Start/End: Complemental strand, 47125631 - 47125531
Alignment:
| Q |
7 |
atcttgagacctgatgttagacttaggagtctcacattgagaagtattagctaaataggtctctaacctaataggaaaatcttttaaattggcctttctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47125631 |
atcttgagacctgatgttagacttaggagtctcacattgagaagtattagctaaataggtctctaacctaataggaaaatcttttaaattggcctttctc |
47125532 |
T |
 |
| Q |
107 |
t |
107 |
Q |
| |
|
| |
|
|
| T |
47125531 |
t |
47125531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University