View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_high_36 (Length: 206)
Name: NF1323_high_36
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 51752505 - 51752609
Alignment:
| Q |
1 |
accagatccggttccaccacccacagcattgaacaccaagaaaccttgcagaccagtacagttatctgctagctttcggatcctgtcgaggcatagatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51752505 |
accagatccggttccaccacccacagcattgaacaccaagaaaccttgcagaccagtacagttatctgctagctttcggatcctgtcgaggcatagatca |
51752604 |
T |
 |
| Q |
101 |
acaat |
105 |
Q |
| |
|
||||| |
|
|
| T |
51752605 |
acaat |
51752609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 17 - 104
Target Start/End: Complemental strand, 18162051 - 18161964
Alignment:
| Q |
17 |
ccacccacagcattgaacaccaagaaaccttgcagaccagtacagttatctgctagctttcggatcctgtcgaggcatagatcaacaa |
104 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| ||| ||| ||||||||||||| ||||| ||| ||||| | ||| |||||||||| |
|
|
| T |
18162051 |
ccacccacggcattgaacaccaagagaccttgaagatcagcgcagttatctgctatctttctgattctgtccaagcaaagatcaacaa |
18161964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 17 - 104
Target Start/End: Original strand, 18307232 - 18307319
Alignment:
| Q |
17 |
ccacccacagcattgaacaccaagaaaccttgcagaccagtacagttatctgctagctttcggatcctgtcgaggcatagatcaacaa |
104 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| ||| ||| ||||||||||||| ||||| ||| ||||| | ||| |||||||||| |
|
|
| T |
18307232 |
ccacccacggcattgaacaccaagagaccttgaagatcagcgcagttatctgctatctttctgattctgtccaagcaaagatcaacaa |
18307319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 35670138 - 35670203
Alignment:
| Q |
1 |
accagatccggttccaccacccacagcattgaacaccaagaaaccttgcagaccagtacagttatc |
66 |
Q |
| |
|
|||||| |||||||||||||| || || ||||| ||||| || ||||| ||||| ||||||||||| |
|
|
| T |
35670138 |
accagaaccggttccaccaccaacggcgttgaaaaccaaaaacccttgaagaccggtacagttatc |
35670203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 40378043 - 40378132
Alignment:
| Q |
17 |
ccacccacagcattgaacaccaagaaaccttgcagaccagtacagttatctgctagctttcggatcctgtcgaggcatagatcaacaatt |
106 |
Q |
| |
|
||||| ||||||||||| |||| || ||||| |||||||| ||||| ||||| ||||||| ||| | ||| | ||||| |||||||||| |
|
|
| T |
40378043 |
ccacctacagcattgaaaaccagaaagccttggagaccagtgcagttgtctgcaagctttctgatgcggtccaagcatacatcaacaatt |
40378132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University