View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_13 (Length: 388)
Name: NF1323_low_13
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 177 - 383
Target Start/End: Original strand, 25579689 - 25579894
Alignment:
| Q |
177 |
gtatcaccctgcaattctaggactttactcgcattgatggctggtttaatgcattgatgttccttttttcgaccctgtgttttggtatagtagttttgaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25579689 |
gtatcaccctgcaattctaggactttactcgcattgatggctggtttaatgcattgatgttccttttttcgaccctgtgttttggtatagtagttttgaa |
25579788 |
T |
|
| Q |
277 |
aaggaaggtagggaagggttatgattttatgatgccgacttcattttgtttggtatcatgatcatatcaaggcaaatgagacgggtggattagttttctg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25579789 |
aaggaaggtagggaagggttatgattttatgatgccgacttcattttgtttggtatcatgatcatatcaagg-aaatgagacgggtggattagttttctg |
25579887 |
T |
|
| Q |
377 |
tggtgct |
383 |
Q |
| |
|
|||||| |
|
|
| T |
25579888 |
cggtgct |
25579894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 30 - 155
Target Start/End: Original strand, 25579566 - 25579691
Alignment:
| Q |
30 |
ctagggacattacattatatatgcaggggttatgattcgaatcctagacatctcattgattaaaaaacaagaagtaaagatgaatattacactaactgat |
129 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25579566 |
ctaggtacattacattatatatgcaggggttatgattcgaaccctagacatctcattgattaaaaaacaagaagtaaagatgaatattacaccaactgat |
25579665 |
T |
|
| Q |
130 |
atcatgaattaccattatcatgtgta |
155 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25579666 |
atcatgaattaccattatcatgtgta |
25579691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University