View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_17 (Length: 352)
Name: NF1323_low_17
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 97 - 290
Target Start/End: Complemental strand, 42280118 - 42279925
Alignment:
| Q |
97 |
cattgggagaggtgaagagaagttcacggagggcttgacggttagcctcaatgttctcaacgttgatgcttgctagacgcttgccaatagttccagtgct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280118 |
cattgggagaggtgaagagaagttcacggagggcttgacggttagcctcaatgttctcaacgttgatgcttgctagacgcttgccaatagttccagtgct |
42280019 |
T |
 |
| Q |
197 |
ctcatctgctgccaagatacccttgccaggggtggctatatacttggcattcttgataagctcatcttgaaatgaaaaccacagtcaattatta |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42280018 |
ctcatctgctgccaagatacccttgccaggggtggctatatacttggcattcttgataagctcatcttgaaatgaaaaccacagtcaattatta |
42279925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 340
Target Start/End: Complemental strand, 42279846 - 42279807
Alignment:
| Q |
301 |
ttcaagttactccctctgtcctaaaataactctcacccta |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42279846 |
ttcaagttactccctctgtcctaaaataactctcacccta |
42279807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University