View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_18 (Length: 344)
Name: NF1323_low_18
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 174 - 263
Target Start/End: Complemental strand, 40021752 - 40021663
Alignment:
| Q |
174 |
gtgtcgttggattagtgcaagatattgatttaatgcagttgttacaagaacgtattcaggatgcgtgtttgatagatattcaagtggtgc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021752 |
gtgtcgttggattagtgcaagatattgactcaatgcagttgttacaacaacgcattcaggatgcgtgtttgatagatattcaagtggtgc |
40021663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 40022329 - 40022282
Alignment:
| Q |
106 |
ggcaagggaggtaaagggggtgttgttgtttgaagtaccagtggaagt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40022329 |
ggcaagggaggtaaagggggtgttgttgtttgaggtaccagtggaagt |
40022282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University