View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_19 (Length: 343)
Name: NF1323_low_19
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 49786204 - 49786367
Alignment:
| Q |
1 |
tccgcatgcgtattggcaaaacatgacatgaataga--ttgggatcgatgagtgatgcagtatacggatattctttgctactgctactgcatgaatcatt |
98 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49786204 |
tccgcatgtgtattggcaaaacatgacctgaatagagattgggatcgatgagtgatgcagtatacggatattctttgctactgctactgcatgaatcatt |
49786303 |
T |
 |
| Q |
99 |
ttctagcatcttcctctgttcatctcgtaccattccatgcaaaagataaacttattacttgtattgt |
165 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49786304 |
ttctagca---tcctctgttcatctcgtaccattccatgcaaaagataaacttattacttgtgttgt |
49786367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 204 - 343
Target Start/End: Original strand, 49786576 - 49786715
Alignment:
| Q |
204 |
atagaatacaccctttttcaacatattctgtcagttgtatatgtacannnnnnnnngtagtctatatgacaaagtattaaagcatataccgtacgtgtat |
303 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49786576 |
atagaatacaacctttttcaacatattctatcagttgtatatgtacatttttttttgtagtctatatgacaaagtattaaagcatataccgtacgtgtat |
49786675 |
T |
 |
| Q |
304 |
tttgttaggaaaagtgatgaggtggcgataatataagatc |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49786676 |
tttgttaggaaaagtgatgaggtggcgataatataagatc |
49786715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University