View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_21 (Length: 329)
Name: NF1323_low_21
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 29 - 319
Target Start/End: Complemental strand, 22091642 - 22091350
Alignment:
| Q |
29 |
aaaagcccaaacataaatgcaaagatttttgaaacgttgaatttgagttatctatatttttgcgtagnnnnnnnngctgaattagttgctatcggctaca |
128 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
22091642 |
aaaagcccaaacataaatgcaatgatttttgaaacgttgaatttgagttatctatatttttgcgtagttttttttgctgaattacttgctatcggctaca |
22091543 |
T |
 |
| Q |
129 |
ttgttgttcgataggaacattacattgctactcctggtgtggcttgtataatttgaacttcaaaatccaccagagacattaatatgcat-tagtcaatga |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22091542 |
ttgttgttcgataggaacattacattgctactcctggtgtggcttgtataatttgaacttcgaaatccaccagagacattaatatgcatgtagtcaatga |
22091443 |
T |
 |
| Q |
228 |
tcttaggttaggtatcagatgggg-ttagccttcttataggttgaggcgctgccacttcatcgaagtttagctgatcctgctgccacttcatc |
319 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22091442 |
tcttaggttagatatcagatggggtttagccctcttataggttgaggcgctgccacttcatcgaagtttagctgatcctgctgccacttcatc |
22091350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University