View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_23 (Length: 313)
Name: NF1323_low_23
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 54910142 - 54909849
Alignment:
| Q |
1 |
acttcccaaacaaacaaacaactcactcagagtcctagtatcactgattccagacataccaaatgcttaggatttgttaaaagataggttcatctttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910142 |
acttcccaaacaaacaaacaactcactcagagtcctagtatcactgattccagacataccaaatgcttaggatttgttaaaagataggttcatctttttt |
54910043 |
T |
 |
| Q |
101 |
gaggtttcataatcagtttgtttatggaaatttaccctcaacttcaatagtgcccatgtcacttagtctttagcttcatgggtttttcaattggcactca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54910042 |
gaggtttcataatcagtttgtttatggaaatttaccctcaacttcaatagtgcccatgtcacttagtctttagcttcataggtttttcaattggcactca |
54909943 |
T |
 |
| Q |
201 |
gtccaatgagtttattagaattataggatgtctaggacccgacaattttcttttgacagtgtcttttctttttgatcaatttcttgatgatgtc |
294 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909942 |
gtacaatgagtttattagaattataggatgtctaggacccgacaattttcttttgacagtgtcttttctttttgatcaatttcttgatgatgtc |
54909849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University