View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_26 (Length: 300)
Name: NF1323_low_26
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 63 - 182
Target Start/End: Original strand, 21269109 - 21269226
Alignment:
| Q |
63 |
aacctgtgaacatgtaaattaaaactcatatacattcacatgcacataaataatcatgatcaagtttaatcactttaagccaggatgacatgagctgaac |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269109 |
aacctgtgaacatgtaaattaaaactcata--cattcacatgcacataaataattatgatcaagtttaatcactttaagccaggatgacatgagctgaac |
21269206 |
T |
|
| Q |
163 |
atccaataaacgcttcagag |
182 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
21269207 |
atccaataaatacttcagag |
21269226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 21269207 - 21269255
Alignment:
| Q |
192 |
atccaataaatacttcagagctaaacaagctcaagacaaacgagtataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21269207 |
atccaataaatacttcagagctaaacaagctcaagacaaatgagtataa |
21269255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University