View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_28 (Length: 284)
Name: NF1323_low_28
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 62 - 213
Target Start/End: Original strand, 39582939 - 39583090
Alignment:
| Q |
62 |
aaaaccaatggcaccagtaagaattgtcagagaaaaagccagttttatttatttattaacataaaccacactcaatcaaattaatgcaaaaaatattcat |
161 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39582939 |
aaaaccaatggcaccagtaagaattgttggagaaaaagccagttttatttatttattaacataaatcacactcaatcaaattaatgcaaaaaatattcat |
39583038 |
T |
|
| Q |
162 |
gtctttaacttctcaataatttgcgatggtaaaagcttagctcttgagaaag |
213 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39583039 |
gtcttcaacctctcaataatttgcgatggtaaaagcttagcttttgagaaag |
39583090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University