View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1323_low_41 (Length: 214)

Name: NF1323_low_41
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1323_low_41
NF1323_low_41
[»] chr4 (1 HSPs)
chr4 (1-87)||(54636782-54636868)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 54636868 - 54636782
Alignment:
1 atcatttcatgctccatatcatcattcaagttaataccctcgatcacaacatcaccttgaatatggcaattgatatcaattttaatt 87  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54636868 atcatttcatgctccatatcatcattcaagttaataccctcgatcacaacatcaccttgaatatggcaattgatatcaattttaatt 54636782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University