View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_5 (Length: 520)
Name: NF1323_low_5
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 453; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 453; E-Value: 0
Query Start/End: Original strand, 23 - 512
Target Start/End: Complemental strand, 3713669 - 3713184
Alignment:
| Q |
23 |
atcatcataatttcttaacttaccgtaacttcaaacatgcactaagtagcctggtcggtaaataaagacatcgaacaactacaattttggagacagatga |
122 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713669 |
atcatcataatttcaaaacttaccgtaacttcaaacatgcactaagtagcctggtcggtaaataaagacatcgaacaactacaattttggagacagatga |
3713570 |
T |
|
| Q |
123 |
attttgcagatcatatatacttgatgctaatttgctgaaaatcttaattccgtatcagttggttcagttatagtatatcccttatggtagggatggtcaa |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713569 |
attttgcagatcata----cttgatgctaatttgctgaaaatcttaattccctatcagttggttcagttatagtatatcccttatggtagggatggtcaa |
3713474 |
T |
|
| Q |
223 |
tgagatgtccctagtgtttaaaaatgatctgaaaatacgggttggggagacaaatgtggacccttgatatcttcagcttcgtttcaaggttcatctttcc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713473 |
tgagatgtccctagtgtttaaaaatgatctgaaaatacgggttggggagacaaatgtggacccttgatatcttcagcttcgtttcaaggttcatctttcc |
3713374 |
T |
|
| Q |
323 |
aaacacctgcatgttctcttaaagatccccttctatcccatacaaaacctacatttaatgcaccttctattctaacattacatataactgaacctagaca |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713373 |
aaacacctgcatgttctcttaaagatccccttctatcccatacaaaacctacatttaatgcaccttctattctaacattacatataactgaacctagaca |
3713274 |
T |
|
| Q |
423 |
ttcatacaaacattgagtctttattcttgttctgcattttatctcaacatggcttcacttcctcttcttctgctcctcatcctctgtggt |
512 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3713273 |
ttcatacaaacattgagtctttattattgttctgcattttatctcaacatggcttctcttcctcttcttctgctcctcatcctctgtggt |
3713184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University