View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1323_low_9 (Length: 419)
Name: NF1323_low_9
Description: NF1323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1323_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 31 - 405
Target Start/End: Complemental strand, 32707829 - 32707450
Alignment:
| Q |
31 |
aattgctcatggattgggttgagcttgttaaaccaacatgataagcacaaaaacttaatttaggttgagtaatttgtatatgaccgatttaannnnnnn- |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32707829 |
aattgctcatggattgggttgagcttgttaaaccaacatgatacgcacaaaaacttaattcaggttgagtaatttgtatatgaccgatttaatttttttt |
32707730 |
T |
 |
| Q |
130 |
-aacttgttggcnnnnnnntgagcaccgagttcgtcaattctactaatgtttccaaaccctagtccatgaggataactatactttatctaacgtat---c |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
32707729 |
taacttgttggcaaaaagatgagcaccgagttcgtcaattatactcttgtttccaaaccctagtccatgaggataactatactttatctaacggatgatc |
32707630 |
T |
 |
| Q |
226 |
ttcaaaacaaattggattggatttatgaataaactacgaattcttgatttcaataatttgttttggagaattttatagaaactcatatctcccaaagtgt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707629 |
ttcaaaacaaattggattggatttatgaataaactacgaattcttgatttcaataatttgttttggagaattttatagaaactcatatctcccaaagtgt |
32707530 |
T |
 |
| Q |
326 |
ttttcatccgttttcatcacaccagttccaaatgtcttaaaccctcactaatcacttggagattttcacccattccctct |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32707529 |
ttttcatccgttttcatcacaccagttccaaatgtcttaaaccctccctaatcacttggagattttcacccattccctct |
32707450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University