View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_high_18 (Length: 249)
Name: NF13240_high_18
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_high_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 39626546 - 39626298
Alignment:
| Q |
1 |
ttatttctggccctttcatctctatcccatcattgtcaagtaaaacaatccccgatgaagtaatgtgaaaagggaaagccaacgggggtgacattggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39626546 |
ttatttctggccctttcatctctatcccatcattgtcaagtaaaacaatccccgatgaagtaatgtgaaaagggaaagccaacgggggtgacattggaga |
39626447 |
T |
 |
| Q |
101 |
ttttgccaacttaataaaccttttacctgcaagaaattgatcatccgaaattcaaatgtgttatgcaaacacaatcatttatcgcaataattatatagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
39626446 |
ttttgccaacttaataaaccttttacctgcaagaaattgatcatccgaaattcaaatgtgttatgcaagcacaatcatttatcgcaataattttatagtg |
39626347 |
T |
 |
| Q |
201 |
attgacacattggcattttgcataggaataccatgttaaatagtataat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39626346 |
attgacacattggcattttgcataggaataccatgttaaatagtataat |
39626298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University