View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_high_6 (Length: 472)
Name: NF13240_high_6
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 236 - 443
Target Start/End: Original strand, 32012612 - 32012819
Alignment:
| Q |
236 |
ttatatttcttgttgttgtctacaatgggccgcggaacagcggcatgttgatgacgtaatcgaccattgaaacgacgtccaaccttggatgcattatttg |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32012612 |
ttatatttcttgttgttgtctacaatgggccgtggaacagcggcatgttgatgacgtaatcgaccattgaaacgacatccaaccttggatgcattatttg |
32012711 |
T |
 |
| Q |
336 |
cgtccatagttgagatgccacaacccatgatgtatataaggactaggaattacgaaaagatcaaattaggagggtaaagagaattgaagaattgggttaa |
435 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32012712 |
agtccatagttgagatgccacaacccatgatgtatataaggactaggaattacgaaaagatcaaattaggagggtaaagagaattgaagaattgggttaa |
32012811 |
T |
 |
| Q |
436 |
caataata |
443 |
Q |
| |
|
|||||||| |
|
|
| T |
32012812 |
caataata |
32012819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University