View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_low_18 (Length: 250)
Name: NF13240_low_18
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 92 - 239
Target Start/End: Complemental strand, 39518650 - 39518503
Alignment:
| Q |
92 |
atttggtatcctatttggaacttcaaaaccaaaccttatgttacaaattacgacacaaactgataaccacaatcataattcgaaagatgacgcccacatc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39518650 |
atttggtatcctatttggaacttcaaaaccaaaccttatgttacaaattacgacacaaactgataaccacaatcataattcgaaagatgacgcccacatc |
39518551 |
T |
|
| Q |
192 |
aacactttatttaaataagtgtgctaacttaatataatggaccttcat |
239 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39518550 |
aacactttatttaaataagtatgctaacttaataaaatggaccttcat |
39518503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 39518710 - 39518648
Alignment:
| Q |
1 |
actacaccctcactctttagtttaccaatacttggagcaaaccacagataacataactgaatt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39518710 |
actacaccctcactctttagtttaccaatacttggagcaaaccacagataacataactgaatt |
39518648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University