View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_low_20 (Length: 248)
Name: NF13240_low_20
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 31214877 - 31214646
Alignment:
| Q |
1 |
ttacaatgcttgtgcagtttttcaaactagttggtattggaccagtaaaatggttgcgaaaagcactgaagtattctagagatccaccagaacatatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31214877 |
ttacaatgcttgtgcagtttttcaaactagttggtattggaccagtaaaatggttgcgaaaagcactgaagtgttctagagatccaccagaacatatttg |
31214778 |
T |
|
| Q |
101 |
aggtggcaaatggccagtaaaatcattattgtctaattggaacatattccagttggtaaagttatatagactttgtggaatgctaccatgaagtttattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31214777 |
aggtggcaaatggccagtaaaatcattcccgtctaatagcaacctattccagttggtaaagttatataggctttgtggaatgctaccatgaagtttattg |
31214678 |
T |
|
| Q |
201 |
atgcgtagtcccaagattattagctttgtcat |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |
|
|
| T |
31214677 |
gtgcgtagtcccaagattattagcgttgtcat |
31214646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 127
Target Start/End: Complemental strand, 31183103 - 31183059
Alignment:
| Q |
83 |
tccaccagaacatatttgaggtggcaaatggccagtaaaatcatt |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
31183103 |
tccaccagaacatatttgagacggcaaatggccaacaaaatcatt |
31183059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 31183171 - 31183131
Alignment:
| Q |
15 |
cagtttttcaaactagttggtattggaccagtaaaatggtt |
55 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
31183171 |
cagtttttcaaacttgttggtattggaccagtgaaacggtt |
31183131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University