View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_low_22 (Length: 238)
Name: NF13240_low_22
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 65 - 219
Target Start/End: Original strand, 9499594 - 9499748
Alignment:
| Q |
65 |
ggtctctgccacggtagttggttgcaccgattttgggtagctaaatgtagccgctgcccaacacatccaaggagtgatgcgtgaccgttatttcatcagg |
164 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9499594 |
ggtctctgccacggtagttggttgcactgattttgggtagctaaatgtagccgctgtccaatgcatccaaggagtggtgcgtgaccgttatttcatcagg |
9499693 |
T |
|
| Q |
165 |
catgtaaaatggggaattacttccccacttctgcatgacccacctatggtgtcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9499694 |
catgtaaaatggggaattacttccccatttctgcatgacccacctatggtgtcct |
9499748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 9499566 - 9499596
Alignment:
| Q |
1 |
aacagctgtgtttagatttaccgtatttggt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9499566 |
aacagctgtgtttagatttaccgtatttggt |
9499596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University