View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_low_23 (Length: 237)
Name: NF13240_low_23
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 3 - 236
Target Start/End: Original strand, 31215065 - 31215298
Alignment:
| Q |
3 |
aacacttttggaggcaaaccagctaggcaagctccacctttcttcaaaccacctaacaggaaagcttccaaaggaacttggatacctgaaatcattactt |
102 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31215065 |
aacactttcggaggcaaaccagctagtcaggctccacctttcttcaaaccacttaacaggaaagcttccaaaggaacttggatacctgaaatcattactt |
31215164 |
T |
 |
| Q |
103 |
caagttaagatcagcaacaatcaattttcaggaaatattccaagtgaaattggattgctacagaaacttgaagattttgatgtaggaggaaacatgttga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31215165 |
gaagttaagatcagcaacaatcaattttctggaaatattccaagtgaaattggattgctacagaaacttgaagattttgatgtaggaggaaacatgttga |
31215264 |
T |
 |
| Q |
203 |
gtggaacaataccaaaagaagttatgaagttgcc |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
31215265 |
gtggaacaataccaaaagaagttgtgaagttgcc |
31215298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University