View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13240_low_27 (Length: 212)
Name: NF13240_low_27
Description: NF13240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13240_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 4620736 - 4620886
Alignment:
| Q |
15 |
gaaaagaaagagcagaaaacaaagaaacaaaacaatatctaacgatcatatacatacaatcgcttacgagtcgggacgatacgaaattgaagaaaaagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4620736 |
gaaaagaaagagcagaaaacaaagaaacaaaacaatatctaacgatcatatacatacaatcgcttacgagtcgggacgatacgaaattgaagaaaaagaa |
4620835 |
T |
 |
| Q |
115 |
agcttgccctggaaggaagagaaatattgtagagaggagcagattggttcc |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4620836 |
agcttgccctggaaggaagagaaagattgtagagaggagcagattggttcc |
4620886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University