View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13241_high_12 (Length: 294)
Name: NF13241_high_12
Description: NF13241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13241_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 7970647 - 7970382
Alignment:
| Q |
19 |
ttggtaatgggattaatggtagtgatcacaggtctagggctaaaatactcgtattgttgaacnnnnnnnggcattgaagaattcttcgcttgcaaggcat |
118 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7970647 |
ttggtaatgggattaatggtggtgatcacttgtctagggctaaaatactcgtattgttgaactttttttggcattgaagaattcttcgcttgcaaggcat |
7970548 |
T |
|
| Q |
119 |
tgcattcacgagaaaagaaaagatcacctgtttgaattgagtctgtactttcgagtgctgatgaataatcatcagtagggttttttgatagtttcacctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7970547 |
tgcattcacgagaaaagaaaagatcacctgtttgaattgagtctgtactttcgagtgctgatgaataatcatcagtagggttttttgatagtttcacctc |
7970448 |
T |
|
| Q |
219 |
tgctatcatttctttgatttctctttctttaactaaacctgttttgaaaggagatttttccctttg |
284 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7970447 |
tgctatcatttcattgatttctctttctttaactaaacctgttttgaaaggagatttttccctttg |
7970382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University