View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13241_low_19 (Length: 251)

Name: NF13241_low_19
Description: NF13241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13241_low_19
NF13241_low_19
[»] chr2 (1 HSPs)
chr2 (1-37)||(1232045-1232081)


Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 1232045 - 1232081
Alignment:
1 attgtggttttgcattacaatcttgttgttattgctt 37  Q
    |||||||||||||||||||||||||||||||||||||    
1232045 attgtggttttgcattacaatcttgttgttattgctt 1232081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University