View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13241_low_9 (Length: 488)
Name: NF13241_low_9
Description: NF13241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13241_low_9 |
 |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 6 - 259
Target Start/End: Original strand, 36794033 - 36794285
Alignment:
| Q |
6 |
cacagagaactcaatgctcgcatacgatggaagtactcagccatggcaagaaaacaccttgctgcttgacgcgtcgttaggatctgattcagacggtgaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36794033 |
cacagagaactcaatgctcgcatacgatggaagtactcagccatggcaagaaaacaccttgctgcttgacgcgtcgttaggatctgattcagacggtgaa |
36794132 |
T |
 |
| Q |
106 |
tggtttggtgccgtagattatctgcctgtaagttcaattcaaatcacaatcaccggttattttcaataaacaaataaatgaataatgatcgatattctca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36794133 |
tggtttggtgccgtagattatctgcctgtaagttcaattcaaatcacaatcaccggttattttcaat-aacaaataaatgaataatgatcgatattctca |
36794231 |
T |
 |
| Q |
206 |
attgttagattaatccaaccacaatttgacttgaggggatggaaaccctagagg |
259 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36794232 |
atttttagattaatccaaccacaatttgacttgaggggatggaaaccctagagg |
36794285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 326 - 472
Target Start/End: Original strand, 36794357 - 36794503
Alignment:
| Q |
326 |
gtgtgtgaaggtgggttgaaaattccaccttttgcttgtagattcaacttaatacaaatatatgaaattacaatgtcagacacagacaaaaagaggttgg |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36794357 |
gtgtgtgaaggtgggttgaaaattccaccttttgcttgtagattcaacttaatacaaatatatgaaattacaatgtcagacacagacaaaaagaggttgg |
36794456 |
T |
 |
| Q |
426 |
agacgaaactgtaatagggtattcttttccctttctacatttgaaac |
472 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36794457 |
agacgaaactgtaatagtgtattcttttccctttctacatttgaaac |
36794503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 133
Target Start/End: Original strand, 18838 - 18962
Alignment:
| Q |
9 |
agagaactcaatgctcgcatacgatggaagtactcagccatggcaagaaaacaccttgctgcttgacgcgtcgttaggatctgattcagacggtgaatgg |
108 |
Q |
| |
|
||||||||||||||||| | |||||| |||||||||| ||| |||| ||||| ||||| |||||||| |||| | ||||| |||||| |||| | |
|
|
| T |
18838 |
agagaactcaatgctcgaagacgatgaaagtactcagacattgcaaccaaacatcttgcagcttgacgaactgttaacaactgatgcagacgatgaactg |
18937 |
T |
 |
| Q |
109 |
tttggtgccgtagattatctgcctg |
133 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
18938 |
tttggtgcctcagattatctgcctg |
18962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University