View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13242_high_11 (Length: 278)
Name: NF13242_high_11
Description: NF13242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13242_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 9960092 - 9959867
Alignment:
| Q |
12 |
aagaatgagaaggtaaaaaagtactgaggggttacatgaactagtgctagccgaaagggaaataagtattatcacgaccaattattaaggttggacactt |
111 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||| |
|
|
| T |
9960092 |
aagaatgagaagctaaaaaagtattgaggagttacatgaactagtgctagccgaaagggaaataagtattattac---caattattgaggttggacactt |
9959996 |
T |
 |
| Q |
112 |
gctttcctcttggaggttagaaagaaaactttgttggacaaaatgttgatcctgtcatctcatttcagataaaagaaaaaagtgtatgaaggcaaccatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9959995 |
gctttcctcttggaggttagaaagaaaactttgttggacaaaatgttgatcctgtcatctcatctcagataaaagaaaaaagtgtatgaaagcaaccatt |
9959896 |
T |
 |
| Q |
212 |
aaacaaatttatggtacactgaggtgaac |
240 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
9959895 |
aagcaaatttatggtacactgaggtgaac |
9959867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University