View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13242_high_8 (Length: 312)
Name: NF13242_high_8
Description: NF13242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13242_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 8 - 302
Target Start/End: Original strand, 42275601 - 42275894
Alignment:
| Q |
8 |
tgcaagaggattgggaacataactagagactttgtgcattttgccatcaagttgttttggcttagacttgtacaaattggtgcaatttttgagctaagag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42275601 |
tgcaagaggattgggaacataactagagactttgtgcattttgccatcaagttgttttggcttagacttgtacaa-ttggtgcaatttttgagctaagag |
42275699 |
T |
 |
| Q |
108 |
taggtttctttaaatgaagttgcggtaggaagagaagagaatatggaaagcatcaaaatatgatactacattacgtgcaggttgttccaatggctttgaa |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42275700 |
taggtttctttaaatggagttgcggtaggaagagaagagaatatggaaagcatcaaaatatgatactacattacgtgcaggttgttgcaatggctttgaa |
42275799 |
T |
 |
| Q |
208 |
gtttgaagaagatctgtgacaatctattgtcttaaagcaaggaccacacgctttattgtacttgctttctattgcctttgccaatttggacaata |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42275800 |
gtttgaagaagatctgtgacaatctattgtcttaaagcaaggaccacacgctttattgtacttgctttctattgcctttgccaatttggacaata |
42275894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University