View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13242_high_9 (Length: 298)
Name: NF13242_high_9
Description: NF13242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13242_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 134 - 288
Target Start/End: Complemental strand, 242637 - 242477
Alignment:
| Q |
134 |
tgtgaaacgcaaaccttggagtcctaagagttaaaggagatgatgataataacagtccggtagccattgaaaccgccatcttctttctttct------ct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
242637 |
tgtgaaacgcaaaccttggagtcctaagagttaaagtagatgatgataataatagtccggtagccattgaaaccgccatcttctttctttctttctttct |
242538 |
T |
 |
| Q |
228 |
ttcactcacagcgagggtttgtttgaatagataatctttgttggtatccctctttctctgt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242537 |
ttcactcacagcgagggtttgtttgaatagataatctttgttggtatccctctttctctgt |
242477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 242771 - 242676
Alignment:
| Q |
18 |
ttttttgggtttcatgataccgcgaattttgccaccggtgggtggaggctgagagacggtggcggaagtaactattcggagtggagccatccgcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242771 |
ttttttgggtttcatgataccgcgaattttgccaccggtgggtggaggctgagagacggtggcggaagtaactattcggagtggagccatccgcaa |
242676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University