View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13242_low_11 (Length: 288)
Name: NF13242_low_11
Description: NF13242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13242_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 22886169 - 22886435
Alignment:
| Q |
1 |
attctctccgaagatcctcgacagcattcctcagcaatccattctccgcctgcaaaacctccatttgcctcttcacagcaaaacatgtctcggccacatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22886169 |
attctctccgaagatcctcgacagcattcctcagcaatccattttccgcctgcaaaacctccatttgcctcttcacagcaaaacacgtctcggccacatc |
22886268 |
T |
|
| Q |
101 |
agcactcatcggaacaccaactccagcagcaccaacctttcctttcttcaaattcttcaaatcgccacattctgccggcaaatgttccaccccaatttta |
200 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22886269 |
agcactcgttggaacaccaactccagcagcaccaacctttcctttcttcaaattctttaaattgccacattctgccggcaaatgttccaccccaatttta |
22886368 |
T |
|
| Q |
201 |
tccatcacaagaaacggaaccctcccaaacgcgctttcgcccttaacctcagccggaaccctaaccc |
267 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22886369 |
tccatcacaagaaacggaacccttccaaacgcgctttcgcccttaacctcagccggaaccctaaccc |
22886435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University