View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13243_high_10 (Length: 385)
Name: NF13243_high_10
Description: NF13243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13243_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 79 - 166
Target Start/End: Complemental strand, 36823863 - 36823776
Alignment:
| Q |
79 |
tggtcgttttagcatatgctaaatggaaaaagttactaggatcataagtatacttcgtcatcgggctttgttatgaaacaaatggcaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36823863 |
tggtcgttttagcatatgctaaatggaaaaagttactaggatcataagtatacttcgtcatcgggctttgttatgaaacaaatggcaa |
36823776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University