View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13243_low_10 (Length: 385)

Name: NF13243_low_10
Description: NF13243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13243_low_10
NF13243_low_10
[»] chr8 (1 HSPs)
chr8 (79-166)||(36823776-36823863)


Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 79 - 166
Target Start/End: Complemental strand, 36823863 - 36823776
Alignment:
79 tggtcgttttagcatatgctaaatggaaaaagttactaggatcataagtatacttcgtcatcgggctttgttatgaaacaaatggcaa 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36823863 tggtcgttttagcatatgctaaatggaaaaagttactaggatcataagtatacttcgtcatcgggctttgttatgaaacaaatggcaa 36823776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University