View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13243_low_12 (Length: 358)
Name: NF13243_low_12
Description: NF13243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13243_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 131 - 342
Target Start/End: Complemental strand, 7998581 - 7998370
Alignment:
| Q |
131 |
ttcaaacgatgcctaccaactgtttgccttttgttcaaaaagaagaaaatatgaacaaattctttgtattttttattgcaatgaccgcctctagtagatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7998581 |
ttcaaacgatgcctaccaactgtttgcgttttgttcaaaaagaagaaaatatgaacaaattctttgtattttttattgcaatgaccgcctctagcagatt |
7998482 |
T |
 |
| Q |
231 |
tgatttgatttgagtttcgcgttggaattttctcttcttttctagaatttttgacactatttttacctccccaattgtttgggactttctggggggtggg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7998481 |
tgatttgatttgagtttcgcgttggaattttctcttcttttctagaatttttgacactatttttacctccccaattgtttgggactttctgaggggtggg |
7998382 |
T |
 |
| Q |
331 |
tggggacctatg |
342 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7998381 |
tggggacctatg |
7998370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University