View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13243_low_22 (Length: 226)
Name: NF13243_low_22
Description: NF13243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13243_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 38918727 - 38918930
Alignment:
| Q |
9 |
gagatgaagatggagacttagcaccaaaaagttcagaaggtaacaaaaccttgcccaattgataaacagccaaaggaaattgttgtctcaaagcattgtt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38918727 |
gagatgaagatggagacttagcaccaaaaagttcagaaggtaacaaaaccttgtccaattgataaacagccaaaggaaattgttgtctcaatgcattgtt |
38918826 |
T |
|
| Q |
109 |
gataggtacagtaacaactccagttgaaacattgacttggttaccttgtgaagtgaagtgaagaccccagttaccttctttaccagaagcttgtgttcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918827 |
gataggtacagtaacaactccagttgaaacattgacttggttaccttgtgaagtgaagtgaagaccccagttaccttctttaccagaagcttgtgttcta |
38918926 |
T |
|
| Q |
209 |
actg |
212 |
Q |
| |
|
|||| |
|
|
| T |
38918927 |
actg |
38918930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University