View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13244_high_17 (Length: 311)
Name: NF13244_high_17
Description: NF13244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13244_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 10407339 - 10407046
Alignment:
| Q |
1 |
tacttagtagtactactggactataaatgnnnnnnngaagtttagttccattgaatagtttgcacaccctaaggtccggccttgctcatgcacaatttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10407339 |
tacttagtagtactactggactataaatgtttttttgaagtttagttccatggaacagtttgcacaccccaaggtccggccttgctcatgcacaatttat |
10407240 |
T |
|
| Q |
101 |
tgaatcaatacaagtacaatgtcaaattctgatgtgaagttagaccaagagaaatttcatggnnnnnnnnntcagttttaccttatgaaaaatacaagac |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10407239 |
tgaatcaatacaagtacaatgtaaaattctgatgtgaagttagaccaagagaaatttcatgg-aaaaaaaatcagttttaccttatgaaaaatacaagac |
10407141 |
T |
|
| Q |
201 |
attgatgtgttgatacacttcggaataggattacttagcacgttggttgacattgatgcaaggtgggtttagttgcaagatgcagcagtaaaaaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10407140 |
attgatgtgttgatacacttcggaataggattacttagcacgttggttgacattgatgcaaggtgggtttagttgcaagatgcagcggtaaaaaa |
10407046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 47 - 81
Target Start/End: Complemental strand, 11290004 - 11289970
Alignment:
| Q |
47 |
tccattgaatagtttgcacaccctaaggtccggcc |
81 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11290004 |
tccattgaatagtttgcacaccccaaggtccggcc |
11289970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University