View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13244_high_21 (Length: 255)
Name: NF13244_high_21
Description: NF13244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13244_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 5371436 - 5371202
Alignment:
| Q |
19 |
ataatacggctgttacttgcctggtattttctgaagatgactcacttctaatatctggttttaaaaatggaagcgtacgagtttggtctctcttaatgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5371436 |
ataatacggctgttacttgcctggtattttctgaagatgactcacttctaatatctggttttaaaaatggaagcgtacgagtttggtctctcttaatgta |
5371337 |
T |
|
| Q |
119 |
cttgatactcatctcgtctctccattttttcacctcttattgtttgttttcccttttgggatta----tatagaagtgctgattattgtgtaaaacacta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
5371336 |
tttgatactcatctcgtctctccattttttcacctcttattgtttgttttcccttttgggattatatatatagaagtgctgaccattgtgtaaaacacta |
5371237 |
T |
|
| Q |
215 |
ctatgcatcatatggttcaggatatttgatgatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5371236 |
ctatgcatcatatggttcaggatatttgatgatgt |
5371202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 12763852 - 12763897
Alignment:
| Q |
33 |
acttgcctggtattttctgaagatgactcacttctaatatctggtt |
78 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||||| |
|
|
| T |
12763852 |
acttgcctggtattttctgatgatgactcactgctgatatctggtt |
12763897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University