View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13244_high_24 (Length: 246)
Name: NF13244_high_24
Description: NF13244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13244_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 42850404 - 42850183
Alignment:
| Q |
19 |
gtgctagtcttgtggaattatatgtgtttggtgttatttgtttgtgataggtttttt-gacaatgggttcagtcttcttgtgagagggcttattataaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42850404 |
gtgctagtcttgtggaattatatgtgtttggtgttatttgtttgtgataggtttttttgacaatgggttcagtcttcttgtgaaagggcttattataaat |
42850305 |
T |
 |
| Q |
118 |
agtgattcttatgtcatgtgtgatcactaattcatggtagtaatccaattgaagtgctattagtgttccaattttc-ccccttttttgctctttgtattg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42850304 |
agtgattcttatgtcatgtgtgatcactaattcatggtagtaatccaattgaagtgctattagtgttccaattttcccccctgttttgctctttgtattg |
42850205 |
T |
 |
| Q |
217 |
ttatctctttgagtgatgatgt |
238 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
42850204 |
ttatctctttgagcgatgatgt |
42850183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 30941520 - 30941734
Alignment:
| Q |
20 |
tgctagtcttgtggaattatatgtgtttggtgttatttgtttgtgataggttttttgacaatgggttcagtcttcttgtgagagggcttattataaatag |
119 |
Q |
| |
|
||||||||| | ||||||||| ||||||||||||||| |||||||||||||||| |||| |||||||||||||| ||||| ||| | | ||| |||||| |
|
|
| T |
30941520 |
tgctagtctggcggaattataggtgtttggtgttattggtttgtgataggtttt--gacattgggttcagtcttcctgtgaaaggacattttacaaatag |
30941617 |
T |
 |
| Q |
120 |
tgattctt-atgtcatgtgtgatcactaattcatggtagtaatccaattgaagtgctattagtgttccaattttcccccttttttgctctttgtattgtt |
218 |
Q |
| |
|
||| |||| |||||||| |||||||||| ||| ||||| ||||||||||| ||||||||| ||||||||| ||| ||||||||||||| ||||||| ||| |
|
|
| T |
30941618 |
tgactctttatgtcatgagtgatcactacttcgtggtattaatccaattgcagtgctattggtgttccaaattttccccttttttgctatttgtatggtt |
30941717 |
T |
 |
| Q |
219 |
atctctttgagtgatga |
235 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
30941718 |
atctctttgactgatga |
30941734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University