View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13244_low_18 (Length: 311)

Name: NF13244_low_18
Description: NF13244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13244_low_18
NF13244_low_18
[»] chr5 (1 HSPs)
chr5 (1-295)||(10407046-10407339)
[»] chr8 (1 HSPs)
chr8 (47-81)||(11289970-11290004)


Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 10407339 - 10407046
Alignment:
1 tacttagtagtactactggactataaatgnnnnnnngaagtttagttccattgaatagtttgcacaccctaaggtccggccttgctcatgcacaatttat 100  Q
    |||||||||||||||||||||||||||||       ||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||    
10407339 tacttagtagtactactggactataaatgtttttttgaagtttagttccatggaacagtttgcacaccccaaggtccggccttgctcatgcacaatttat 10407240  T
101 tgaatcaatacaagtacaatgtcaaattctgatgtgaagttagaccaagagaaatttcatggnnnnnnnnntcagttttaccttatgaaaaatacaagac 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||    
10407239 tgaatcaatacaagtacaatgtaaaattctgatgtgaagttagaccaagagaaatttcatgg-aaaaaaaatcagttttaccttatgaaaaatacaagac 10407141  T
201 attgatgtgttgatacacttcggaataggattacttagcacgttggttgacattgatgcaaggtgggtttagttgcaagatgcagcagtaaaaaa 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
10407140 attgatgtgttgatacacttcggaataggattacttagcacgttggttgacattgatgcaaggtgggtttagttgcaagatgcagcggtaaaaaa 10407046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 47 - 81
Target Start/End: Complemental strand, 11290004 - 11289970
Alignment:
47 tccattgaatagtttgcacaccctaaggtccggcc 81  Q
    ||||||||||||||||||||||| |||||||||||    
11290004 tccattgaatagtttgcacaccccaaggtccggcc 11289970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University