View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13244_low_24 (Length: 253)
Name: NF13244_low_24
Description: NF13244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13244_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 36733286 - 36733429
Alignment:
| Q |
14 |
cacagacattcggtgacattttatattcttcctagtttggaatcagtcatacgttttaagaatatgttgccgtccttggccttcctnnnnnnnnttgaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36733286 |
cacagacattcggtgacattttatattcttcctagtttggaatcagtcatacgttttaagaatatgttgccgtccttggccttcctaaaaaaacttgaga |
36733385 |
T |
 |
| Q |
114 |
gcaacacataatcgtccttttccaaatcaaataacgaatatgat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733386 |
gcaacacataatcgtccttttccaaatcaaataacgaatatgat |
36733429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 174 - 207
Target Start/End: Original strand, 36733417 - 36733450
Alignment:
| Q |
174 |
taacgaatatgatcaaacacaaactacaatataa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36733417 |
taacgaatatgatcaaacacaaactacaatataa |
36733450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University