View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13244_low_25 (Length: 248)
Name: NF13244_low_25
Description: NF13244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13244_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 49700111 - 49699913
Alignment:
| Q |
1 |
ttcttttaacgcacttgcaccttccaaatttgaaaaactaacatgatcacgctgcttgtcactgcaacttgactggctgagagcctgagacaactgaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49700111 |
ttcttttaacgcacttgcaccttccaaatttgaaaaactaacatgatcacgctgcttgtcactgcaacttgactggctgggagcctgagacaactgaact |
49700012 |
T |
 |
| Q |
101 |
atacaaagtgaagggtcttatgcatatatcatacagtagctggttttaattcacatcagtatg--atatgtattgaataaattttcacatatttattga |
197 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
49700011 |
atacaaagcgaagggtcttatgcatatatcatacagtagctggttttaattcacatcagtatgatatatgtattgaataatttttcacatatttattga |
49699913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University