View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13245_high_33 (Length: 237)

Name: NF13245_high_33
Description: NF13245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13245_high_33
NF13245_high_33
[»] chr3 (1 HSPs)
chr3 (7-237)||(49477019-49477249)


Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 49477019 - 49477249
Alignment:
7 atacttgcatggtagttggttaataggtgtgctgggaacgattgaggagttttattgtatgttcagtaattgcccaaacaaatgtgaataataagggaaa 106  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
49477019 atacttgcatggtagttggttaataggtgtgctggaaacgattgaggagttttattgtatgttcattagttgcccaaacaaatgtgaataataagggaaa 49477118  T
107 ctctgcatttcacaattggcattgaattatcatcacaaataaacaagctattagtcaatggcattgctggcccttttgaatgttgggtaatgccagggga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49477119 ctctgcatttcacaattggcattgaattatcatcacaaataaacaagctattagtcaatggcattgctggcccttttgaatgttgggtaatgccagggga 49477218  T
207 ctcacctgttgtttgttatgtctaaaaccaa 237  Q
    |||||||||||||||||||||||||||||||    
49477219 ctcacctgttgtttgttatgtctaaaaccaa 49477249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University