View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13245_high_33 (Length: 237)
Name: NF13245_high_33
Description: NF13245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13245_high_33 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 49477019 - 49477249
Alignment:
| Q |
7 |
atacttgcatggtagttggttaataggtgtgctgggaacgattgaggagttttattgtatgttcagtaattgcccaaacaaatgtgaataataagggaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
49477019 |
atacttgcatggtagttggttaataggtgtgctggaaacgattgaggagttttattgtatgttcattagttgcccaaacaaatgtgaataataagggaaa |
49477118 |
T |
 |
| Q |
107 |
ctctgcatttcacaattggcattgaattatcatcacaaataaacaagctattagtcaatggcattgctggcccttttgaatgttgggtaatgccagggga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49477119 |
ctctgcatttcacaattggcattgaattatcatcacaaataaacaagctattagtcaatggcattgctggcccttttgaatgttgggtaatgccagggga |
49477218 |
T |
 |
| Q |
207 |
ctcacctgttgtttgttatgtctaaaaccaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49477219 |
ctcacctgttgtttgttatgtctaaaaccaa |
49477249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University